Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14325F1
Clone ID IST14325F1
Vector VICTR74
Project tigm

Sequence tag IST14325F1HMR1
Sequence
NATTTGTATTTAATATATCTTAATGTTTCTTTAACAGGCACTGTANAGCACCTCTGGTTGGGGAGGGTGTTATGTGAGGT
TTAAATGGAGCTGTACACGGGGTCACTTGTAAATTANCCTTTCTATTTGTCATACACATTTACTAGCCAGATTTTACCAA
GGACTGTCC
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66650360..66650526 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]


Sequence tag IST14325F1BBF1
Sequence
ATCTGAAAAGCAGTTAAAAGAAACCATGATTTCTTAAAGTGGCAATCAACTATGTAACCATAGTAATTTTTGTACTTAAC
ACACATCAAAAATTAAACAGATTCATGTTAAAATGGAAACAAATGGATTTTGTAGCTTTAATAAAGTTTCTCTGCTGTAG
GTGCTCTGGAATGTACAGACAGTAGAACTCATGCATAACTAATTCATGACTCTAAAGACATTCTATGAGGAACTTCCTCA
GCCTAAGGGGAAGCAAGCCCAGTANAATATGGCCCTAATCACAAAAGACTTGAATCTTTGAAACCCCAAGTGAAAGACAC
TAACTTAAAACTGAACATTTANTTGAAACANATCACCTTTTTCCATTTTGTTAGGGGATTCAGAGTTCTGTTAAGGTCAT
CTGTNANTGTNAACCNAACTTTAAAAATAGCCTANAGCCNAAATANANCGGCTGANANCNNATATNTCTAGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66649890..66650361 440
 
EST/CDNA Est Name
  BB627678.1


Sequence tag IST14325F1HMF1
Sequence
ATCTGAAAAGCAGTTAAAAGAAACCATGATTTCTTAAAGTGGCAATCAACTATGTAACCATAGTANNNNNNGTACTTAAC
ACACATCAAAAATTAAACAGATTCATGTTAAAATGGAAACAAATGGATTTTGTAGCTTTAATAAAGTTTCTCTGCTGTAG
GTGCTCTGGAATGTACAGACAGTAGAACTCATGCATAACTAATTCATGACTCTAAAGACATTCTATGAGGAACTTCCTCA
GCCTAAGGGGAAGCAAGCCCAGTAGAATATGGCCCTAATCACAAAAGACTTGAATCTTTGAAACCCCAAGTGAAAGACAC
TAACTTAAAACTGAACATTTAGTTGAAACAAATCACCTTTTTCCATTTTGTTAGGGGATTCAGAGTTCTGTTAAGGTCAT
CTGTTAGTGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66649951..66650361 399
 
EST/CDNA Est Name
  BB627678.1

 
Come back to gene BB627678.1


For any suggestions or comments, please send an email to unitrap@crg.es