Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14919C6
Clone ID IST14919C6
Vector VICTR76
Project tigm

Sequence tag IST14919C6HMR1
Sequence
TATGCAGCTATCTGGGAAGGAAGGCAGGATTTTGATTTCTGAAAGTGTTGCCTGTGTTTGTGGTTTCCGGTTACTTTATT
TATTTATGTATGTGCGGGTGTGTGTCC
Sequence Type genomic DNA
Unitrap ID UNI12335

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127385405..127385510 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031984 (2810004N23Rik) NM_025615 RIKEN cDNA 2810004N23 gene Gene [Source:MGI Symbol;Acc:MGI:1913773]


Sequence tag IST14919C6HMF2
Sequence
CATACACCTCTGACCCTTAGTAATACAATTACGCTAGTCCTCACACCCGGTGCCATCAACGTCATAGTTCCCAGGACCAT
GTTAAAAGCATTTGCCTCTATACTAGCATGTCTTTTTACCNCACTGCAGGGTTACAGGTACATGTCCGGGTTCTTCTTGT
TTTCCTTCGGTTTTGGATTTAAAGGGAATCCAGCTAAACTTTAATTGCTTTAATTTGAATACCTTTACTTTCTACTCTAT
TTCTCATCTTCAGTTTGTTTCTTCTGCTCAGACTCTCAACAGTGATCTGAAATTTCAATCAGGCGTCTAAGCCTCAGTAC
TGACCTACAGTATGGGCCCAGGAGCTTTCTGAATACTANCTGTGTACTTGTGGNCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127385507..127385882 370
 
EST/CDNA Est Name
  BB856728.1 - CF104496.1 - CX215297.1 - CF897255.1 - AA387679.1 - AA387504.1 - BY242982.1 - BY243190.1 - CF156992.1 - BI789298.1 - CJ166545.1 - BY272461.1 - BY245915.1 - BE286021.1 - CX222847.1 - BY277313.1 - BY290584.1 - BY251934.1 - BI690950.1 - BY250683

 
Come back to gene BB856728.1 - CF104496.1 - CX215297.1 - CF897255.1 - AA387679.1 - AA387504.1 - BY242982.1 - BY243190.1 - CF156992.1 - BI789298.1 - CJ166545.1 - BY272461.1 - BY245915.1 - BE286021.1 - CX222847.1 - BY277313.1 - BY290584.1 - BY251934.1 - BI690950.1 - BY250683


For any suggestions or comments, please send an email to unitrap@crg.es