Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10104C1
Clone ID IST10104C1
Vector VICTR76
Project tigm

Sequence tag IST10104C1HMR1
Sequence
AATACCTACGATGTCTTTTACANNNGCTAATATGGACATTTAAACAATATCCTACTGCTTTCCCAGTGAAACCGCTCAGA
GGGTGATGATGCCTGGATTAGATCAGCAGAACCCACCTAGTAGAGGGAGAGGACGGGCTCCCTGTGGCTGTCCTCAGACC
CACATGTGCACACACACTAACTAACTAAACAAATGCAATCTAGTCCATCTTTCTCTTTTGTGTTGTTTAATTTTTCTTTT
TTAAATCATTTAGCAAATATACAGACACATTTAAAAAGGAAAAGGACTAAAAAAAATACTGAATTAAAACATAAATGTGT
ACAATTATTGCCAGGAAATTGAGAAGATTCAGGGAAGAAATTAGAAAAATCTTGAATGACTTGACTTTCTTTTTTTGTTT
GTTTGTTTGTTTTTTTGAGACAGGGTTTCTCTGTGTTCCCCTGGCTGTCCTGNAACTNNCTCTGTANACNNNGNNGNCCT
CCAN
Sequence Type genomic DNA
Unitrap ID UNI2063

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62238525..62239007 457
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es