Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14703G9
Clone ID IST14703G9
Vector VICTR76
Project tigm

Sequence tag IST14703G9HMF1
Sequence
AGTTGGGGAGAAGGGTACAGGAAGAGATTTGGGTTTTTTTTTCGTGCTTGGTCCAGGTTTTTACCAGCAAAGCCAAAACC
TTTGCTGGAAAAAAAGGGGGGATTTGATTCCTTTCTTAATCNTGTAATTACAATCCTTCCNNCTGGACCGGGCTACGGTG
GGAGTCGGGGGGGGGGC
Sequence Type genomic DNA
Unitrap ID UNI16727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26654917..26655092 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031565 (Fgfr1) NM_001079909 fibroblast growth factor receptor 1 Gene [Source:MGI (curated);Acc:Fgfr1-001]


Sequence tag IST14703G9BBF1
Sequence
NNNNGNGGAGAAGGGTACAGGAAGAGATTTGGGTTTTTTTTTCNTGCTTGGTCCAGGTTTTTACCANCAAAGCCAAAACC
TTTGCTGGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14703G9HMR1
Sequence
AACTGGGTCTTTAATCCATTGCTCCTCTTCCTCCTAGTTTAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 26654879..26654920 42
NO GENE  

 
Come back to gene ENSMUSG00000031565


For any suggestions or comments, please send an email to unitrap@crg.es