Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14183F10
Clone ID IST14183F10
Vector VICTR74
Project tigm

Sequence tag IST14183F10HMF1
Sequence
CTCTCCAGACACACTTGGCACCCCCTGCCCCACAGGCTGGGATTGCAGGCTTGCCCCACATGCTGGGATTGCAGACTTGC
CCCTTATTGCCCAGCTGGCTTCTAAATGGAAAAACAAAAACAAAAACAAAAACAAAAACAAAAAAACCCCAAAAAAACCC
AGANCAAAACAAACCAACAACAACAAATAAAGAGGAAAGGAAAGGACTAACTGCTCCTAGGTATGGTGGAGGAGAAAATT
CATTATAGATATAAGGGANGCATANCCNAAGGCAAANCCCATACACCTGGGANANTCCANANTGNTCATGANAGTGAACC
ATGTGAGGANAGGGGAGGGTGGGGANANAGGGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14183F10HMR1
Sequence
GGCCTGGGGTTTTTCCCGAAGCAACCAGGCTGGGGTTAGCGTGCCGAGGCCATGTGGCCCCAGCACCCGGCACGATCTGG
CTTGGCGGCGCCGCGTTGCCCTGCCTCCCTAACTAGGGTGAGGCCATCCCGTCCGGCACCAGTTGCGTGCGTGGAAAGAT
GGCCGCTCCCGGGCCCTGTTGCAAGGAGCTCAAAATGGAGGACGCGGCANCCCGGTGGANNGGNCGGNTGAATCACCCAC
ACN
Sequence Type genomic DNA
Unitrap ID UNI22301

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 78328771..78329012 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037742 (Eef1a1) NM_010106 eukaryotic translation elongation factor 1 alpha 1 Gene [Source:MGI (curated);Acc:Eef1a1-001]


Sequence tag IST14183F10BBF2
Sequence
NNNGNNAAAGGGNGGGNGNGCTGAGGTANGCACTATTTCTATTTTCAAACTGTTCCGCCAAATCTTCCCTCAACAACAGC
CGGCCTCAGGCTGCTGAAACCAGCTGGATTAGCATGGGTTCCTCCACCGCCTGGGAAGGCAAACCCATACAGTATATGGG
TGCCTCCCTCCCTCAGCCAGCATAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 74877354..74877536 173
 
EST/CDNA Est Name
  CO815709.1 - BE863212.1

 
Come back to gene CO815709.1 - BE863212.1


For any suggestions or comments, please send an email to unitrap@crg.es