Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14714B6
Clone ID IST14714B6
Vector VICTR76
Project tigm

Sequence tag IST14714B6BBF1
Sequence
GTCTGTTTGGCACCACCGTCATGGGCACTGACCCTATTGCAACCACCACCACCTACATACAGACAGTCATGGAGAGAGAT
CTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100248667..100248748 82
NO GENE  


Sequence tag IST14714B6HMR1
Sequence
AGANNNAATGAGGAACCCACATCAAGTAGGTGCAGATGCCCATGGGCCTTAAAGTGGCCCCAAGCCCTCAGAGCAAGGTG
AAAGTCCTCAACAGCAGTGACCACCCCAGAGGGCCTGTCCCACTCCGTGCTGCTAGCCCGAGTTCCGGGAAGTGGACGAT
GAATGAACACCCTAGGGGTGAGGCAGTTAGGATAGCAACAACCTGGTCCCCAACAGTGAACACCTACTAAGTGCTGTCAC
CATAGCGAGTCCTTCCTAANCACTATTCTCACAGCATTCAGTTGAGCATGGTGGACCGTGAGTTTGAAC
Sequence Type genomic DNA
Unitrap ID UNI29544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100248363..100248664 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es