Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15105G11
Clone ID IST15105G11
Vector VICTR80
Project tigm

Sequence tag IST15105G11HMR1
Sequence
ATGTGTACGAATGTCTGTGTACATAAGTGCAGTGCCTACAGAGGTCAGAAGAGGGCGTAGGAACATCTANAACTGGAGTT
AAAGACAGTTGTGAGCCACCATGAGAGTCCTGAGTACTGAATCTGAGTCCTGCAGGAACAAGAATGCANTTC
Sequence Type genomic DNA
Unitrap ID UNI31688

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3047912..3048061 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023764 (Sfi1) NM_030207 Sfi1 homolog, spindle assembly associated (yeast) Gene [Source:MGI (curated);Acc:Sfi1-001]


Sequence tag IST15105G11BBF2
Sequence
NNNNNNCCTGCGTTTGATCCCCAGGAATTCACACGGTAGGAGGAGATATCGGCCCCTAAGCTTCCGGATTCCTTTTCTGT
GAGAAATACAAGCTCCCAAGTCCAGGGATCAGTAGCCTCAAAGCCTCTACTCGCTGCACAAGCTGTGTGGAAACAACCTG
ATTAACAGAGGCAAACACTCACAAAACGTGCTTTGTGCTTTGTAATGTCACCCGAGTACGCAAAGCACGCTTTCCAGGGA
CTCAGACTCGTACTGTGAATGAGAGAAACCGTGCCGACATGGTTCTTGAGTAACCTGCTCCCCGCAATGGTTCATGGGTA
TCCTATGCCCCTGANCTCTGACTATCCAGAAAGCAGGCCCTAGGCTCAGACACCTGAAGTGCAAGATGANGTGGAAAGCA
AGTGTACAGCTCATTTTTTGANGGTAGACTGCTGAAGGAACTGGTTGATCNNGCACTAAAGCGTGACAGGAGCAGCCCTC
TGGNCTCANCGGAAGCCGGTGACGCACCACTTCTCGGGNTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 82933406..82933920 499
 
EST/CDNA Est Name
  BG081528.2

 
Come back to gene BG081528.2


For any suggestions or comments, please send an email to unitrap@crg.es