Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14579D2
Clone ID IST14579D2
Vector VICTR74
Project tigm

Sequence tag IST14579D2HMR1
Sequence
CAGGGTTTTGCTTTTTAAGTACAAAATGAGGAAGTTGGATCTTTGATTTTTAAGGTATCTTTGANCATTANAATTGTGGG
TCAATTTTCTTTTTTGTAATAGTGTTTTTTTTTTTNNNTTTN
Sequence Type genomic DNA
Unitrap ID UNI11537

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29139502..29139616 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]


Sequence tag IST14579D2BBF1
Sequence
CCTGCAGGTCTAAAGGTTTGTAAAATGTTTTTCTTCTTAAATTTAAAATCTCATTTCCTACCACATTAACCTATACTTGG
CTTATTGTTAGACAAACTAAACTGCTCCAGCATAAGTGACCGAATTCAAAAGTTTGTCCTTAGCCAGCTTTCTTTTGTGT
AAAATCAATGAATTTACTTCCTCCACCTCCCTCCCTAGTGGAATTTTTTTTGATATGGTGTGACTGCGTANCCCACACTG
GCCTANAACTCACTATCCTTCACCACCCAAATGCTGTGGTTACAGGTGTGTACCTCCATGCCTAATGGGTTCTGTCCTTT
TACCCCAACAGGAAGTANAGCAAAATTCAGGAGGAGCANAAAGCCATTTTCTTTTTTTTTCNAGATAGGGTTTCTCTGTG
TAGGCCTGGCTGTCCTGGAACTCACTCTGTANNCNAGGCTGACCTCNANCTCAGAANTTNNCCTGCCTCTGCCTNNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29139613..29140086 448
 
EST/CDNA Est Name
  BF161325.1 - CF898054.1 - CF895984.1 - BB621175.1 - BY738412.1 - BB628364.1 - BU613381.1 - BY750361.1 - CF902400.1 - CF898026.1 - BU148477.1 - CN681339.1 - BB222366.2 - BB637427.1 - BF730918.1 - CF162146.1 - CN697829.1 - CA879214.1 - BB853315.1 - CD543509

 
Come back to gene BF161325.1 - CF898054.1 - CF895984.1 - BB621175.1 - BY738412.1 - BB628364.1 - BU613381.1 - BY750361.1 - CF902400.1 - CF898026.1 - BU148477.1 - CN681339.1 - BB222366.2 - BB637427.1 - BF730918.1 - CF162146.1 - CN697829.1 - CA879214.1 - BB853315.1 - CD543509


For any suggestions or comments, please send an email to unitrap@crg.es