Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14428C9
Clone ID IST14428C9
Vector VICTR74
Project tigm

Sequence tag IST14428C9HMR1
Sequence
GTATATAAAACCCAGANCCTGCATATGCTAGGCAAACATTATGCCACTGCGATATGTCCCTGTTAATTCCCAGTTACTAA
TGTTGAAAGCAGGATTGTAAAATAATACATTTATTTGAAGGTGCCTAAGTTCTCTTTATAATTAAATCTGTGTCTTAGTT
GTAGTAGTGATGGTTTAAAGAATTATCACCTCGTGATTGACTGGCATTAAATGTTAGATCTTANCTTCAAGTCCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI2259

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127504939..127505176 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071072 (Ptges3) NM_019766 prostaglandin E synthase 3 (cytosolic) Gene [Source:MGI (curated);Acc:Ptges3-001]


Sequence tag IST14428C9HMF1
Sequence
TACAGCCTANAACAAAAGTATACAGCAAGGTGTTAGTCATCCCAGACTGCANGANACTAAGGTAAGCGGACTGCAATTTT
AGGATGGTTCAGAGTACACACCAGGCTATTGTTCCACAGAACAAGAACAAGGGCTGGAGAGCACTTGCTACTCTTGTAGA
TGATCTGGGCTCAATAACCAGCACCCACATGTCAGCTCACAACCAGGTGTAACCCCAGTTCCAGGGGATCCAAAGTCAAT
ANNNNNNNNNNNNNNNNNCACACAAAACCATAGGAGGGACCATGTGTATGTAGCCNAGCTCTNCNACTTGAGGTGGCCCC
TGANATGCACCCAGTTTTGGAAAACACCTGCNAGTTGTCTTGACTTCCAAACATGTCCANTGGTNNANGTNNNCNCNNCA
NAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127504555..127504938 235
NO GENE  

 
Come back to gene ENSMUSG00000071072


For any suggestions or comments, please send an email to unitrap@crg.es