Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12369B4
Clone ID IST12369B4
Vector VICTR76
Project tigm

Sequence tag IST12369B4BBF1
Sequence
ACGATGACTACCTAGGAACAGCCTCAGGCTGGAGAGGGGTTCTGAGGAAGGAAGGGGTGTCTGGGAGCAGCAAAATCAAA
GAACTCCAAGTCAAACAGCAGGATGAGTCAAAGCCAGCAGCCTGAGCTCTGCCCGAGACAACTCAACAGCATGCTTCCTC
TCTGGTCTGTTTCCTGGAGCTTTCCAGATAGCACCTACTCTCTCACTCTCTCTCTCTCTTCTGCTTGAGACAGCTCTCCA
ANAAGTTCTCTCTTGCTGTTCTANAAAATTTCTCTGGATAACTCATCTCTTGCAGATCAAAACCTTGTCTTTTATTTTAC
ACATCAATCCAGTCATTTACTCCAGGTTCCCTTTGGACTAGCCNATGAATCAGCATCAAGTGGAACCCACCCCCCCAACC
CTGCCCCTTAATTCTTANGAGACTGCAAACACAAACAACCTTCTTTTTAGAGTTGCNAAAGAATTCAGANATCTGT
Sequence Type genomic DNA
Unitrap ID UNI31160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28625404..28625878 463
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074243 (AC164532.4-202)  


Sequence tag IST12369B4HMF1
Sequence
ACGATGACTACCTAGGAACAGCCTCAGGCTGGAGAGGGGTTCTGAGGAAGGAAGGGGTGTCTGGGAGCAGCAAAATCAAN
GAACTCCAAGTCAAACAGCAGGATGAGTCAAAGCCAGCAGCCTGAGCTCTGCCCGAGACAACTCAACAGCATGCTTCCTC
TCTGGTCTGTTTCCTGGAGCTTTCCAGATAGCACCTACTCTCTCACTCTCTCTCTCTCTTCTGCTTGAGACAGCTCTCCA
AGAAGTTCTCTCTTGCTGTTCTAGAAAATTTCTCTGGATAACTCATCTCTTGCANATNAAAACCTTGTCTTTTATTTTAC
ACATCANTCCAGTCATTTACTCCAGGTTCCCTTTGGACTANCNNATGAATNNNCATCAAGTGGAACCCACCCCCCCNACC
CTGCCCCTTAATTCNNANGAGACTGCANACACAAACNACCTTCTTTTTAGAGTTGCAAAAGAN
Sequence Type genomic DNA
Unitrap ID UNI31160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28625417..28625878 430
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074243 (AC164532.4-202)  

 
Come back to gene ENSMUSG00000074243


For any suggestions or comments, please send an email to unitrap@crg.es