Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14657H1
Clone ID IST14657H1
Vector VICTR74
Project tigm

Sequence tag IST14657H1HMR1
Sequence
CTCCAGCTNNAAGATTTATTCTTTACATAAATAAGAACACTGTAGCTATGGCGTCAGATCTCATTGCGGGTGGTTGTGAG
CCACCATGTGATGAACTCAGAACCTTTGGAAAAGCAGTCAGTGCGTTTACCTGCTGAGCCATCTCACCAGTCCCTGGCCT
TGAACTCTTGATCCTTTTGTCTGANTCACTGGAATGAGTGGAATTTCTTAAAACCTTCTGTTTTAGAACATTTGGATGGA
TATGTGCGCCTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34935966..34936221 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]


Sequence tag IST14657H1BBF1
Sequence
GAGCGAACAGGGACTGATTGAGTGGGGCGGACCTGAGCGAGCAGGATTGACTGGAGCGAGCAGAGGTCCTAAATTCAGAT
CCCAACAACCACATGAAGGCTCACAACCAACTGAACAGCTACAGTGTGTACTCATATACATAAAATAAATAAAATATCTT
TAAAAAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34935801..34935968 168
NO GENE  

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es