Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15104H6
Clone ID IST15104H6
Vector VICTR80
Project tigm

Sequence tag IST15104H6BBF2
Sequence
CCACATGCCTTTCTCCTTTAGTGCATGACTTGATTTGTAACCTTGGGTTTGAACTCAAAGAAATTTGTGATATCAATAGC
ATTGTAACTCAAAATGGTGAAGTACGATGGAAAGCAATTACTGACCGTGTGAGATATGAAGAATTAGGTTTGTATTCTCT
TTGTACATCAAGCTTCCGTTAGTACTGTAACATTAAAAATTTGTTGTGTGGTTAAACCTTCATTTGTTCTTCTTGAAGAG
TGTTATAGTGTGGTTGTAAATCAGAGGAGAAATATTCAAAAGTCAAGAGAGGTTTAGTTAAGGGCATAATGTAAGCAGGA
GGGCCAAGAANGCAGGGTCTAAGAGATACTAGACTATTCTAGTATCTTANGGCTTGGATCCC
Sequence Type genomic DNA
Unitrap ID UNI14648

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15116487..15116867 377
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]


Sequence tag IST15104H6HMR1
Sequence
TANNGAGCNGACAATGTAAAAATTTCTACTACTTAAGTATTANCATGANATATACTCTGGTTCTTCTGATCCATCCTGAC
TTTGGCNAATTANAATATAATTTACCNNTAGCTTCCTTAAGACCACATCNNGAGTTTATCATANAGTTGAAGAATCTATG
TCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es