Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14849F9
Clone ID IST14849F9
Vector VICTR76
Project tigm

Sequence tag IST14849F9HMR1
Sequence
NGGAGTATGTACTTCTTAANANGCATTATTTTCTTTTTTTCTCCTTAATTCCTCTGGATCCTTAGGGTGTGGAATGGTGT
CTTTCATATTCAGGGTAGGTCTTTTTCCTTTGGAAAGTCCTCACAGACAGATCCAGGTGCACCACATGGGTCTCCTGGGG
TGGAAATTCTAAATCCTGTCATGTTC
Sequence Type genomic DNA
Unitrap ID UNI20489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17760695..17760878 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037369 (Utx) NM_009483 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome Gene [Source:MGI (curated);Acc:Utx-001]

 
Come back to gene ENSMUSG00000037369


For any suggestions or comments, please send an email to unitrap@crg.es