Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14186D3
Clone ID IST14186D3
Vector VICTR74
Project tigm

Sequence tag IST14186D3HMR1
Sequence
NCTGGTGTTATTTTTGTCTCTTTCCCCTCTCCTGTTTGTGTTCTTCAGCCAAAACTGTAAGATATGTTTGATTTGTGTAC
CAAGTAGTTTCAGCAGTTTCAAATTACTC
Sequence Type genomic DNA
Unitrap ID UNI23500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112278216..112278322 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032745 (Gpbp1) NM_028487 GC-rich promoter binding protein 1 Gene [Source:MGI (curated);Acc:Gpbp1-002]


Sequence tag IST14186D3HMF1
Sequence
NANNAAATGCTTTANCNNCTTANATAATCCNTTTGACCCAAAATACTGAANAAATGGCTGGGACTTTTANTANCTCNTTN
AATTTGTTCACTACTATCAATTCNCTTCANANATGATTCTTGTCAATTTTAATGAACTTCTGGANCAAANTTGCCCAAAA
CNAAAANCAAAACTGTAATTCCAAAATGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14186D3BBF2
Sequence
GGCCCAGCACACTGTGGGTGGTGCGACCCCTGAGCTGTAAGAAACAGACTGAGCAAGAGATGAGGAACAAGCCAGCAGGC
AGCACTCCTCCATGGCCTCTGCGTTGGTTTCTGGCTCGAGTTCCTGCCCTGGCTTCCCTCAGGGATGGAGTGTGATTAAT
AATAGACCTGTCCCTCCCCAGGTGCCTTTTGGTCATGGTGTTTATCATAGGAATCGAAAGCTAACTAGGGTAACCTCAAA
GATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30633435..30633679 245
NO GENE  

 
Come back to gene ENSMUSG00000032745


For any suggestions or comments, please send an email to unitrap@crg.es