Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12285C6
Clone ID IST12285C6
Vector VICTR76
Project tigm

Sequence tag IST12285C6HMF1
Sequence
CATGTATGTGTGCCTGTACATATGCCACAGTGAATATATGGAGAGCATGGCTTTTGGGGATTA
Sequence Type genomic DNA
Unitrap ID UNI20062

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101968543..101968604 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027860 (Vangl1) NM_177545 vang-like 1 (van gogh, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2159344]


Sequence tag IST12285C6BBF1
Sequence
TTAAAGGCGTGTGCCACCACTCCCGGCTTCCGGCTATGACTTTTAAGAGAGATACTAAATATTAATGCCTTCTGGTTTCT
AGGCTTGTTTGCGTTTTGCATTGGTTTCTTTTCTTGGGGCCCATAATACAACCAGGGTTACAAGCACAGGAATTAGCAGC
GTGACTGACCACAGAGCCACCTCCCTACACTATTTTTTTAGATTACCTAAGATTTAAATTCAAGCTACCCGAGTAATATA
TTAGCAGCTTCCCCTTGGAGACTAAATCAGGTAATCCAGAAGTGTGTCTGGTAAAACATGGCCGCCCTCTTTGAATTCCT
GACCCAAGGTTTCTCTGTCTGCTGTCCCTCAAATACACAGTTTCTCAAGGTAGCTTGCCAAACTGTTCGTTGGTGAGGGT
CAGTATACTTTTCTTTTTTATACTAATTAATTAGTTTACATGAGTGTGTGTTTTGCCTGCACATATGTGTGCAGTACATA
CACGGGCTACAGGAGGGCCCANNATCTCCTCANAACTAGAGGTACNGGGGCTGGTGAGANGGCTCANANGGTAANANCNC
CTGACTGCTCTTCCNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168615044..168615617 554
NO GENE  

 
Come back to gene ENSMUSG00000027860


For any suggestions or comments, please send an email to unitrap@crg.es