Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14639H7
Clone ID IST14639H7
Vector VICTR74
Project tigm

Sequence tag IST14639H7HMR1
Sequence
TACCCCCTTTACCAACTGGGTGGCCCCCAGCTCCGTGTATTTCNAACTAACTTCTTCATTCAGCTGGTGCGGCCTGGTAC
TGCACAGCCTGAANATACCGTGCAGTTCCGGATCCCCATGGAGT
Sequence Type genomic DNA
Unitrap ID UNI24210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 149720911..149721034 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037772 (Mrpl23) NM_011288 mitochondrial ribosomal protein L23 Gene [Source:MGI (curated);Acc:Mrpl23-001]


Sequence tag IST14639H7HMF1
Sequence
GAGGTTATACACACAGTACTGCAGGCTCATGTGTCCACTCACATCAGCANAATCGAGGCAGGGTGGGACAGTTACACATA
GGACCTGTCCCTACTATATGGTTTCATTANTAGGGGGGACAAGCAGCTTCCCAGCCTAGTCCTTGGCCTCCCTACTGGGT
TCCAGGGCTACTGACACTACAGCCTTCCTATANAAAGGTCAAAAGGACAGCTAAAAGAGAGAAAGAAAGAAACAAAAACN
NGANNNNANGCTCATAGCTGTGGTATGGGAGCANAATANTGGTCCCANCTTGTAAAATTGTAANAACAAGGAAGGANNGA
CCTCATAAACNNGGCAGTGNTGGTNCTCANCTTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000037772


For any suggestions or comments, please send an email to unitrap@crg.es