Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14608G6
Clone ID IST14608G6
Vector VICTR74
Project tigm

Sequence tag IST14608G6HMR1
Sequence
AGCAAGCACTTTTAATTGCTGAACCNTCTTCTTGGCCCCCATTTGACAAGGTTTTACTATGAAGTCCAGTCTCATGATCA
CTCTGCCTCAGCCTCCCCGATGCTAGGATTATAGGCATGCGGTACCACACACAGACCTTTAGTGATTTTTGTTGTTGTTA
TATTCATAGACGGATTTCAAGTCATAGGACTTGAATAGTCTTGCGAGAGTTAGGATGGATCTGTTTTCCCTGGTGATATA
AAAGCTGGGCCAGACAATTTCACAAGTACNGGANAGCCNTCNGTGGCCTTGGACTAAGCTGGTGGCAGTCTGGACTGTTG
NTTCTCGANAAAAAGTTTCTTCCCAAANATAATGTCTTCANNNNNNCNNNNNNNNNNNNGGANGCCGAGGGAANCNANTC
TGNNTNTGTGANNTCNNNTGTGANTGNNNGGANCCN
Sequence Type genomic DNA
Unitrap ID UNI903

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4618161..4618520 344
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014301 (Magmas) NM_025571 mitochondria-associated protein involved in granulocyte-macrophage colony-stimulating factor signal transduction Gene [Source:MGI (curated);Acc:Magmas-001]

 
Come back to gene ENSMUSG00000014301


For any suggestions or comments, please send an email to unitrap@crg.es