Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14697F2
Clone ID IST14697F2
Vector VICTR76
Project tigm

Sequence tag IST14697F2BBF1
Sequence
CTTTAACTGCTGACGTATCCATGGCAACATGTGTGACTTTTGAGAGTTGGGCATAATTTACAAACTCCAAAGGGAAGCTC
CACAGTAAAAGTTGCATGAAGCCATAGAAGGCTGACCTCATTTTAAAGTGTGTCAAGTGGGATGGGCAGGGAATTATATC
AAAATTGATAATGTAGAATGTTTATAGAGTGCTAGCTGGATTTTAAGGATTAGAAATAATATATTCATTTTAATTTAAGT
AAATAGTGTATAAAATAGATAGGGAAGGTATGGAATAAAGAGCTTCCGAAATGTCTCAAATATATTTAAATTTTGTGATA
TGATTAAAGTAATCGTGAANATGTGCTACGACTAANAAGAAAGTAATAATTTTGGNCCCTTATCTACAGTTTTCGGTGAG
AGGGAAAGAAAAGCGAGGTGCANAATTGTATCTNNNTCNANATACNANGTCTNNNTACTGCAANAGTTNGN
Sequence Type genomic DNA
Unitrap ID UNI31699

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22082233..22082700 438
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033581 (Igf2bp2) NP_898850 insulin-like growth factor 2 mRNA binding protein 2 Gene [Source:MGI (curated);Acc:Igf2bp2-001]


Sequence tag IST14697F2HMF1
Sequence
CTTTAACTGCTGACGTATCCATGGCAACATGTGTGACTTTTGAGAGTTGGGCATAATTTACAAACTCCAAAGGGAAGCTC
CACAGTAAAAGTTGCATGAAGCCATAGAAGGCTGACCTCATTTTAAAGTGTGTCAAGTGGGATGGGCAGGGAATTATATC
AAAATTGATAATGTAGAATGTTTATAGAGTGCTAGCTGGATTTTAAGGATTANAAATAATATATTCATTTTAATTTAANT
AAATAGTGTATNAAATAAATAGGGAANGTATGGAATAANGANCTTCCNAAATGTCTNNNATATATTNAAANTTTNTGATN
TGATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000033581


For any suggestions or comments, please send an email to unitrap@crg.es