Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11675F3
Clone ID IST11675F3
Vector VICTR76
Project tigm

Sequence tag IST11675F3HMF1
Sequence
GTTGTAGAAGACATTTTATGTGCTGGGTAGCACTCCAATATTAAGCCCTGATGTACAAGGGTAGAGTTGATGATGTTATG
GATTCATCAATGCTTAGGTAATATTAAGTGACACTAAGTAGAATGTAGCTGAGGTAGGGCTGCCTGTAAAACACCTGACA
GGTATGTAGTATGCTAAGCAGTCCTGTTAAAGATTATTATGGA
Sequence Type genomic DNA
Unitrap ID UNI12387

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177056408..177056609 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078869 (OTTMUSG00000016577) predicted gene, OTTMUSG00000016577 Gene [Source:MGI Symbol;Acc:MGI:3649811]

 
Come back to gene ENSMUSG00000078869


For any suggestions or comments, please send an email to unitrap@crg.es