Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14797A5
Clone ID IST14797A5
Vector VICTR76
Project tigm

Sequence tag IST14797A5HMR1
Sequence
NNATATTTACCTTTTTAAAAAAAGAGAGAGCGTGAGCGAGCACTCCTCACTGTGTAGTCTTAGCTCCCTAGAACTTTGTA
GATCAGGTTC
Sequence Type genomic DNA
Unitrap ID UNI21327

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34712929..34713015 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009630 (Ppp2cb) NM_017374 protein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform Gene [Source:MGI Symbol;Acc:MGI:1321161]


Sequence tag IST14797A5BBF1
Sequence
ATTAACTCTCTTTTATCCCGAGAAATGGCTCAGCAGCTAACGGTGCTTGATGCTCAAGCCTGAAGACTAAAATGTGATCC
CCATAGCCCACATAAAAGTGGCATTCTCCACAAGCTGTTTTTTTGACCTCCCCATGTGCACTCACAAACACATCATACAA
AATCAATGTGCACACGTGCATATGCCCAAACACACACATATGCGCATACACCCATACAAATACATTAAAAACAAAACCTT
TAAGAAAACTAGCTAAAAGGAATGAAAGCGGGTGACTGTANACCGCTTGTCTCTGTTACAACCTTCCTACGAGGCTTTCT
AGCTCAGGAAGGGCANANTATTTATTCTCAAGACCAAGTGGGAAGTAAGGACGTCGCTTTACAGCGTTGCTGTAAACCTG
GTAACGTGTGTGCTGAAGATAACAGGAAACACACGGCNNACGGANCCAAAGTCTCCNTTGAACTNCNGTCCCCAGANNTN
CCACTANNNCAAGANTGACAACCGANNCNNANCANAACTCNNTTCNCATGTAANANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14797A5HMF1
Sequence
ATTAACTCTCTTTTATCCCGAGAAATGGCTCAGCAGCTAACGGTGCTTGATGCTCAAGCCTGAAGACTAAAATGTGATCC
CCATAGCCCACATAAAAGTGGCATTCTCCACAAGCTGTTTTTTTGACCTCCCCATGTGCACTCACAAACACATCATACAA
AATCAATGTGCACACGTGCATATGCCCAAACACACACATATGCGCATACACCCATACAAATACATTAAAAACAAAACCTT
TAAGAAAACTAGCTAAAAGGAATGAAAGCGGGTGACTGTANACCGCTTGTCTCTGTTACAACCTTCCTACGAGGCTTTCT
ANCTCAGGAAGGGCANANTATTTATTCTCAAGACCNAGTGGGAAGTAAGGACGTCGCTTTACAGCGTTGCTGTAANCCTG
GTAACGTGTGTGCTGAAGATAACAGGANNCNCNNNGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 34712504..34712930 415
NO GENE  

 
Come back to gene ENSMUSG00000009630


For any suggestions or comments, please send an email to unitrap@crg.es