Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11536F6
Clone ID IST11536F6
Vector VICTR76
Project tigm

Sequence tag IST11536F6HMR1
Sequence
NNCCAGCTCCAGCCTCCCTGTCTGCCCTGGCCCATTTCACTCTGAGCTTTTTCTTCCTTCATTTTGGGGAGACATTCCTA
ATTACTTCTTTCATTCCTCTCTCCCACTGCACACACNGTAGGGGAGTGGGGGGTTGTGGTGGCCTGTCCCTACACCACAC
TTTTCTTACCTGTGGCACTGGACNGGATGCNCCTGTGCTGGGTGTCCCCACCCNTGCGTGTTN
Sequence Type genomic DNA
Unitrap ID UNI13655

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73198536..73198755 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031848 (Lsm4) NM_015816 LSM4 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene [Source:MGI (curated);Acc:Lsm4-001]


Sequence tag IST11536F6BBF1
Sequence
AGGAGACNTAGCTNNACACANANCAGCTGCAGGTGTTATANCCNCCCGTTCTGGAATCCAGTCCCAGCACCTCCCATTAG
AGGAGCCAGTTCCAGGAAGGGAAATTCCTTCTCAGCCATCATCCAGACTCTNTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031848


For any suggestions or comments, please send an email to unitrap@crg.es