Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14419C7
Clone ID IST14419C7
Vector VICTR74
Project tigm

Sequence tag IST14419C7HMR1
Sequence
CGTTTAGTTTTTGCTCTTANATATTGTATATACTAATCCTCTGGCAGGTACCACCTAACAGGTGGCCTTTTCAGTCC
Sequence Type genomic DNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22403997..22404073 71
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


Sequence tag IST14419C7BBF1
Sequence
AACGAAACACCAAGAAAACAAATGATCCCATTAAATGTGGACTAGAAGAACTACATGCAGCCAAGAGCGCTTCAAAGCGT
CCTCTCCTTAGCTACAAAGGCAAACTACATTACTGTAAGATTCTACCTCACCCATCAGAATTGCTAAGATTAAAAAAACA
AAAGACACGCTTCTTTTTAATAGATTTAACCAAGTAGTTGGACTTAGATTTGAATCAATCTGTGTCATCAGGTGCTAACA
GATTTCTAGAACATCAAGACTTAAGCCAGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22404070..22404345 276
 
EST/CDNA Est Name
  CF896949.1 - BI107369.1 - BY015297.1 - BF141696.1 - BY322994.1


Sequence tag IST14419C7HMF2
Sequence
GTCCGAGGTGGTCAGGTAAACACGGCAGTTAGTCACACGGCCTCTGCCCTCAGGAAGCACAGGAAAGGGGGCTGGGCTAC
AGAGCCTCAAGGCCCTCTTCTGGCAACGCACTTCCTCCACTGAGGCTCCACCTCCTAAACCGTCCACAACCTCACACAGC
ACCGCCAGCTGGGCACCGAGTGTTCAAACACTTGAGACGGCGGGGGGACGTTTCACATTCAAACCAACCATCTGTTTTTA
GAGTCGCACTGTTGGTCAAAGCATTGTTTGTTGGTTACCCTTTAGTGAAGCATTCCTCTTGGGAGAAGCAACCAAAGATT
GTGCTGTTTGACTTTGGGTGAGGGTGGGGGGNNCTGNNANNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70042500..70042855 352
NO GENE  

 
Come back to gene CF896949.1 - BI107369.1 - BY015297.1 - BF141696.1 - BY322994.1


For any suggestions or comments, please send an email to unitrap@crg.es