Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14968D5
Clone ID IST14968D5
Vector VICTR76
Project tigm

Sequence tag IST14968D5HMR1
Sequence
AAGGGACCTGCACTTCTGTAGCCNGGTAATTCTCTTCGTATGGGTCAAGCTGGGAATAGCTTTTTCTGAAGCAGTTAGCA
AGANAAATTCTCCCCAAGTTTTCATTTACACTTTANAGTCCCCCCTCCCCCTCCCACACCGGTCTTCTAGGCAGACAGTA
GTGCAGAAACTGATGTCNNCTCANATACTTTGCATTTTGGGGATACCTTANGCTGTGGCTCANTGCTCTCTGCCTCCCCT
CTCCTTCCCACCANTTTTTTTTTTC
Sequence Type genomic DNA
Unitrap ID UNI18303

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123348290..123348553 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]


Sequence tag IST14968D5HMF1
Sequence
CCTTCCTAATATAGCAGTCTCCTTCAGAAGGAACAGTGCCTCAAAATGTGCTCATAAGCCCAGGGGCAAGCTGGGTGTGA
AGGTTCACACCTTAAGTGCCAGAACTTGGGAGGCCGAGGCAGGAAAACTGCTACAAGTGCCATCCCGGAACTCACTATAA
TAATAAACAGTCTCAGGAGCCAAAACAAAAGAAACAGCTCANAGATAGTTGCGTCCTGTCAAAGGCACTGGACCACAGGA
TGGACGGAGATATATATAGTCAAATTGGAAAAAGAGGTTAANANGAACGTCNACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123348550..123348843 286
 
EST/CDNA Est Name
  CN692189.1 - CJ088681.1 - BY072371.1 - CJ064494.1 - AV086717.1 - BY790715.1 - BY071946.1 - BY060167.1 - BU841175.1 - CJ172097.1 - CF161925.1 - AA930708.1

 
Come back to gene CN692189.1 - CJ088681.1 - BY072371.1 - CJ064494.1 - AV086717.1 - BY790715.1 - BY071946.1 - BY060167.1 - BU841175.1 - CJ172097.1 - CF161925.1 - AA930708.1


For any suggestions or comments, please send an email to unitrap@crg.es