Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G030C05
Clone ID G030C05
Vector U3CEO
Project ggtc

Sequence tag G030C05
Sequence
CGCGATGATGAACACGGAGTAGCATNNNTGGTGAGCGTGCACGTGGAGCACCCTCAGGAGGCATCAGTGGTGGTGCACCA
AGTGGAACGTGTGTCGGGCCCCTGGGAGGAGGCGAACCCTGAAGCCCTAGCCAGGGCTGAAGCGGCGGCACGGGCCGAGG
CGGCGGCGCCCTACACAGTGCTGGCACAGAGCGCGCCACGNNAGGACGGCTAGTCAGACGCCTCCGGGTTCGGTTGCTGT
TTTAGAAAACTGCGCGTAAGTCGAATGTGCATGGCCGGTATCAAGNNNCCCGCACCTCGATAGGTGTGGCAAGCTAAGAT
ATGAGATGTAAATCTGNNGGCGGTCTCNATTGGCGTCCCGGANCCGCCGNNCCACGGGTTGCCGCGTCTCCGGGGAGGAG
TTAACGATGG
Sequence Type mRNA
Unitrap ID UNI11239

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28114575..28115161 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040488 (Ltbp4) NM_175641 latent transforming growth factor beta binding protein 4 Gene [Source:MGI (curated);Acc:Ltbp4-001]

 
Come back to gene ENSMUSG00000040488


For any suggestions or comments, please send an email to unitrap@crg.es