Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14393E5
Clone ID IST14393E5
Vector VICTR74
Project tigm

Sequence tag IST14393E5HMR1
Sequence
GGTAAGGCCTAGGAAGTACGAGGTGAGGGGTTAGGGACTGGGTGTCNAAGAGGCGTANCTGCAGTCCCTTTTGTTTGTTA
GTCAGGTGGAGTGAGTGGTAAGTTTCTAGAACCTCAGCACATAGAGTTAAGGGCTTGTTT
Sequence Type genomic DNA
Unitrap ID UNI30160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23566453..23566592 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020280 (Pus10) NM_001033654 pseudouridylate synthase 10 Gene [Source:MGI (curated);Acc:Pus10-004]

 
Come back to gene ENSMUSG00000020280


For any suggestions or comments, please send an email to unitrap@crg.es