Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11423B10
Clone ID IST11423B10
Vector VICTR76
Project tigm

Sequence tag IST11423B10BBF1
Sequence
AAAGTGAGTTCCAGGACAGCCAGGGCTATACAGANAAACCCTGTCTCGAAAAAG
Sequence Type genomic DNA
Unitrap ID UNI30554 UNI31708 UNI31709 UNI31710

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10881660..10881713 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024670 (Cd6) NM_009852 CD6 antigen Gene [Source:MGI Symbol;Acc:MGI:103566]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 15716669..15716722 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047161 (Chst9) NM_199055 carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9 Gene [Source:MGI (curated);Acc:Chst9-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 30834448..30834501 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 94483401..94483454 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 36438130..36438183 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8425362..8425415 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42400338..42400391 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21448027..21448080 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 51325384..51325437 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86529443..86529496 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 29977498..29977551 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 86583606..86583659 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 107768297..107768350 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029279 (Brdt) NM_001079873 bromodomain, testis-specific Gene [Source:MGI (curated);Acc:Brdt]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33047547..33047600 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 18566525..18566578 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 27405569..27405622 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 34617261..34617314 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037529 (Tesp2) NM_009356 testicular serine protease 2 Gene [Source:MGI (curated);Acc:Tesp2-002]


Sequence tag IST11423B10HMF1
Sequence
AAAGTGAGTTCCAGGACAGCCAGGGCTATACANNNNAACCCTGTCTCGAAAAAGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000037529


For any suggestions or comments, please send an email to unitrap@crg.es