Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14175E3
Clone ID IST14175E3
Vector VICTR74
Project tigm

Sequence tag IST14175E3HMR1
Sequence
TTATATTTTTATTTTGTATGTAAACAGAGGAAAGGATAATTTATGGGAATCTCAGACTCACCATGTGATTGTGTCCTGGA
GGTCAAATTCTGGCTGCCCAGCTTGGTGGCTGTGAGCCCAGGTATAACCTTTGAGTTATACCTCCGTTTTGTTTTTGTTT
TTCTGANACAGGGTTTCTTGGCGAAACACCCTAGGCTGTCCTGGACTANTANACCAGGTTGGCCTCCACCTGCCTCTGCG
TTCTGANCTCTGGGATTCTTTGTTTTGTTTTCTTTTTTAAGACAGGGTCTTCCTCAGCCCAAGGCCTGGANCTTGCTGCA
NTTTTCTGCCTTANCCTTCTGAGTACAGGTGTGAGCCAGCGTGAGCCANCCTTTATTGCTTTTTANATGGTAGTATTTTT
GTTTTN
Sequence Type genomic DNA
Unitrap ID UNI17235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72836562..72836966 387
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034563 (Ccpg1) NM_028181 cell cycle progression 1 Gene [Source:MGI Symbol;Acc:MGI:1196419]


Sequence tag IST14175E3HMF1
Sequence
TAACCAAGGCAAAGTGATGAGAGTTACTCCTCCTAAGGTCGCTAATGACGAAACACAGTCACTATTCTTTAGAAGAACAG
AAGCAAAGATGTAGACTAATGAATTGTATAATTTTATCTGTTCACACTGAATCTAACAAAAAAATTAAATATAGCTCAAA
TTATCAGACATATAAAGCCTACTACTTAATTATCTTCAAACAGGGTCTGTTAGCCAGGATAACCGTGGACTCCTGATTCT
TCTTCTGACCTCCCATGTATAAGGATTATAGGCAAGTTCTATCACTCCAAGCTAACTCCCACTTGTAAATGCTTACAAAT
AAACAAGCTGTTTTCAGCTGAACATGGTGGCCCGGGTCAGTGAATCAGAGACCAGCCAAGGGTACAGTAAGACTGTCTCC
TGCCCCTCCACATATTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72836144..72836564 421
 
EST/CDNA Est Name
  BE985840.1

 
Come back to gene BE985840.1


For any suggestions or comments, please send an email to unitrap@crg.es