Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10545D3
Clone ID IST10545D3
Vector VICTR76
Project tigm

Sequence tag IST10545D3BBF1
Sequence
GGGAAACCGAGGCTGAGGTAGGGGACGTGACTTTTCCCTGTGACCTCGACAGATCATTAAATGTGCTGTAAGGTTCTTTT
TTTTTTTTTTTTTTTTTTTTTTTTT
Sequence Type genomic DNA
Unitrap ID UNI1974

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91570988..91571091 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040506 (Ambra1) NM_172669 autophagy/beclin 1 regulator 1 Gene [Source:MGI (curated);Acc:Ambra1-001]


Sequence tag IST10545D3HMR1
Sequence
CCACTGAACCTTTTGGAGGTGANCNTGGGTCATCTCTTTGAAGAGAAAGGTGGGGCCATGGCTGGTGTCTTCTTGGAACT
CCAGTTCTAGACTCTACCTCAGGCAGCAGGACTGCAGGTAAGCATGTACCCCCATGATTCAAATGGGAAAGCTGATGTGA
GGTGAAAGGCGAGGGAACGAGAGAACCCCACCCGTGTGCCTGTGGAAGGGACTGCAGCCCCTCCAAAGCTCGGAGTAACC
NNCANGGTCTGACTTTCCTTTGAATCTTTAANTCCTACTGCGGCTACCCCGCNNGCCTGANCCNGGTNTCCGCTGCTTTC
CCTAANCNTCCNNNCNCGGGATACTGGGGAACNTGGGTTCCGGNGCCNNNCTNTNANNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040506


For any suggestions or comments, please send an email to unitrap@crg.es