Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13201G3
Clone ID IST13201G3
Vector VICTR74
Project tigm

Sequence tag IST13201G3HMR1
Sequence
CCTTCNAGGGAACTCAACGAGGCCTACAAATGATCAGGCACCAGGTAGAGGTTAAAGAAAGCAGTTTCTGCCAGGCAGTG
GTGGCACACGCCTTTAATCCCAGGCAGAGGCAGGCGGATTTCTGAGTTCAAGGCCAGCCTGGTTTACAGAGTGAGTTCCA
AGACAGCCAGGGCTATGCAGAGAAACCCTGTCTCAGAAAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI8117

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4963863..4964072 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000061374 (Fiz1) NP_001103799 Flt3 interacting zinc finger protein 1 Gene [Source:MGI Symbol;Acc:MGI:1344336]


Sequence tag IST13201G3HMF1
Sequence
AAGGCCTGTGTTCCATGTAGGGGAAATTGATCATTGTANAATAAAGGAGGTGGGTGTACATGGACCTATTGGGTGTACAC
TAACATATTTTCAAGATGGTGTAAACACACGGCTGCGGGGCAAATTTACTAGCCAGGGCCATCACTAGCTGCCTTTCCCT
GAGTGGAATGGAGTCCCAGTGTCTGAGCCACATGTGGCTCCCCGGACTCACCTGGTGGTGCAGCAGGCCAGTGGAGTCTC
GGAATCCCTTAGGGCAGGCAGAGCATCGGTAGGGTCGTTCACCANTGTGTGAGCGCAGGTGGTTAGCCNAGTTGAAGCTA
TGCTTGAAGCCCTTACCGCATCGAGGACATGCGTGGGGCTTGANAGCCGTGTGTCNAGCAAAGTGGCGCCTCANGTCTGA
TCGGTAACGGAAACTCTTGCCACATTCGCTACAGTGAAAGGGGACCCGANGCGCANTGGCAGATGGTGCTGGTCCTGNNN
CANCGATGGGGGCNNNANCCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4964069..4964570 470

 
Come back to gene Mm.38911


For any suggestions or comments, please send an email to unitrap@crg.es