Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11022A7
Clone ID IST11022A7
Vector VICTR76
Project tigm

Sequence tag IST11022A7BBF1
Sequence
TTTGCTCATACCCAGGNTTAATATGAAAGCATATTATAATATTTCTTTTTTTAAAGATTTATTTATTTATTATATTTATA
TGAGTACACTGTAACTGTCTTCAGACACACCAGAAGAGGACATCGGATCT

Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56873023..56873149 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


Sequence tag IST11022A7HMF2
Sequence
AATAATTCNNGTNNGNNNNNNNNGTANCCANNNNNNNNANN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038816


For any suggestions or comments, please send an email to unitrap@crg.es