Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14570F8
Clone ID IST14570F8
Vector VICTR74
Project tigm

Sequence tag IST14570F8BBF1
Sequence
ATGGGTTGAATAGCAGCAAGAAAGTCTCGGGTGAGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31718

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52972916..52972956 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059070 (Rpl18) NM_009077 ribosomal protein L18 Gene [Source:MGI (curated);Acc:Rpl18-001]


Sequence tag IST14570F8HMF1
Sequence
ATGGGTTGAATAGCAGCAAGAAAGTCTCGGGTGAGAGATCTAGTAGGATTTCCTGAACTTCAGTTCTGTTTAGTAAGTTG
AGCATAAGGAAAAGGCAGCCGAGAATTTAAGGAAGTGTGAGATGAGCTTTTTCTTCAGGGCGGGATAAGCCTCACCTCCG
ACACACAGCCCACCGGGTCCTCCGCGAGCCACCGAGAAGCGGTCGGCGTGCGGCCAGAGAGTCACCACGCGACTCGTCCA
GCAAGCTCCGATCATGTCTCTGATTCTCCGGTCCCTTTACCCCTGGAGAGTGTTAGAGCAGGGACGGGGAAAGGCCAGAG
AGGCTCCGGGTCCCAGCCCTTTCCTCAGGCTGACTTCTCTTTGGTTCTGGAAGCCTCGGTTTACTCGGTCCTCCCACATA
CCATCGAGAAACCCAAATTGTGGTANAGCTCCGCGTCGCGCTCATGTGACGTCNNCCCGTGCNCCACAGANANNCCAGTT
NNNNANAGAGTGNCCCNCATTGCGTCACGAGTGCNTNTCGCAGGCCNCTNTTTNCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52972916..52973451 497
 
EST/CDNA Est Name
  AK151990.1

 
Come back to gene AK151990.1


For any suggestions or comments, please send an email to unitrap@crg.es