Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G026G10
Clone ID G026G10
Vector U3CEO
Project ggtc

Sequence tag G026G10
Sequence
CTTTGACAAATACACTGGGAACACTTACAAAGTGGGTGACACTTATGAGCGCCCTAAAGATTCCATAATCTGGGACTGTA
CCTGCATCGGGGCTGGGAGAGGCAGGATCAGCTGTACCATTGCAA
Sequence Type mRNA
Unitrap ID UNI10563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 71697136..71697260 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026193 (Fn1) NM_010233 fibronectin 1 Gene [Source:MGI Symbol;Acc:MGI:95566]

 
Come back to gene ENSMUSG00000026193


For any suggestions or comments, please send an email to unitrap@crg.es