Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G086D09
Clone ID G086D09
Vector U3CEO
Project ggtc

Sequence tag G086D09
Sequence
CGGATGTGCCAGTATTTAACAAGGCCCTGCTCACCTCAGAACAAGATTTCCTTCGGTTGCTGTGGGCGTTTCACTGCTGC
CGAGCTGCTGTCGTTCTCCCTGTCTGTCATGCTCGTCCTCATCTGGGTTCTCACTGGCCACTGGCTTCTCATGGATGCTC
TGGCCATGGGTGTGGGGGTTGCCATGATCGCCTTCGTCCGCCTGCCAAGCCTCAAGGTTTCCTGCCTGCTTCTCTCAGGG
CTTCTCATCTACGATGTCTTCTGGGTGTTCTTCTCAGCCTACATCTTCAACAGTAATGTCATGGTGAAAGTGGCCACACA
GCCAGCTGACAATCCCCTCGACGTTCTGTCCAGGAAGCTCCACCTGGGACCCAATGTGGGGCGGGATGTTCCTCACCTGT
CTTTGCCTGGACAATTGGTCTTCCCAAG
Sequence Type mRNA
Unitrap ID UNI11248

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115533471..115538995 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029550 (Sppl3) NM_029012 signal peptide peptidase 3 Gene [Source:MGI (curated);Acc:Sppl3-001]

 
Come back to gene ENSMUSG00000029550


For any suggestions or comments, please send an email to unitrap@crg.es