Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14255D12
Clone ID IST14255D12
Vector VICTR74
Project tigm

Sequence tag IST14255D12HMR1
Sequence
CTATGANGCCGGGAGGGGAACCAATGCTAGAAATTCATGTCTACATGCTATACTCTGGCTCGTTCTGGTTTCCATTGTGC
CCTAAGTTTCCCCATCTGTAATGCGGAGGTGGTGTAAN
Sequence Type genomic DNA
Unitrap ID UNI31724

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97558298..97558414 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018537 (Pcgf2) NM_009545 polycomb group ring finger 2 Gene [Source:MGI (curated);Acc:Pcgf2-001]


Sequence tag IST14255D12HMF1
Sequence
ATAGACCCAGCTCTGCAAGCAAATCTCATGTGTTCATGTACGAGTCAGAGGGGTTCTGCACCAGGACACAAAATCTCTTA
TCTTTTCTTTCTTTCTTTTTTTTTATTATTTATTTATTCTATGTAAGTNCNNTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97558411..97558545 129
NO GENE  


Sequence tag IST14255D12BBF1
Sequence
ATAGACCCAGCTCTGCAAGCAAATCTCATGTGTTCATGTACGAGTCANAGGGGTTCTGCNCCAGGACACAAAATCTCTTA
TCTTTTCTTTCTTTCTTTTTTTTTATTATTTATTTATTCTATGTAAGTACNCTGTANCTGTCTTCAAACACTCTANAAAA
NCGAGTCAAATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000018537


For any suggestions or comments, please send an email to unitrap@crg.es