Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14923F7
Clone ID IST14923F7
Vector VICTR76
Project tigm

Sequence tag IST14923F7BBF1
Sequence
TTATGTCTCCAGAATTTGGGACACCTTTAACCCTAACAATCCTACCCTCTGGCATTAATTTTCTATATAGAGTGAAACAA
GATGCTTAACTCTTTCTTAGTTTATTTGCTCTTTTACCACAACATAAGAGAAATGTATTAATCAAAAAGTCATAATGTAC
TTGACTAATACATTCTCATACTCTGGAACAAGTTATTCTCATGGGTCTTTTGTTTGTCTGTCTGCCTANAGGCTGTTCTG
AACACAAGCCACCTGGCCATGGCCCCAGTCACCCAAGACTGTGGGGCTCANCAGGGAAGGGCTTGCNNTGCGCGGATGGC
NACTGGGGTGGNANCN
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34933247..34933577 321
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]


Sequence tag IST14923F7HMF1
Sequence
TTATGTCTCCAGAATTTGGGACACCTTTAACCCTAACAATCCTACCCTCTGGCATTAATTTTCTATATAGAGTGAAACAA
GATGCTTAACTCTTTCTTAGTTTATTTGCTCTTTTACCACAACATAAGAGAAATGTATTAATCAAAAAGTCATAATGTAC
TTGACTAATACATTCTCATACTCTGGAACAAGTTATTCTCATGGGTCTTTTGTTTGTCTGTCTGCCTAGAGGCTGTTCTG
AACACAAGCCACCTGGA
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34933247..34933502 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es