Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14285E5
Clone ID IST14285E5
Vector VICTR74
Project tigm

Sequence tag IST14285E5HMR1
Sequence
AATGAAAAGTGTACACTACCACGACCCGCTCANTTTGTTTTGTAAAAGAGACAAATTGTTTTCGGCTGGTTTGAGCAACA
CAAGTCTTAAATCTCTGTGATTCTCTTCAACTCCATAGAGTTCCAGGACAGCCAGGTCTCCTTGAGGCAGGATCTCTCAG
TCAAACCCAGAGCTCATTCCATAGAGCTAGTCTTGGTANCTAACTTGCTCTGGGGATTCTGTCTCCATCTTCCAAGGTAN
GAATTACAGGANGTCTTCCATGCCTGCTCANCATTGCCTTGGGTTCTGGGGATCCAAATTTANAACCNTCTCCTTATTCC
CNTCNTTCCTATCCAGCCCCCCCCCCN
Sequence Type genomic DNA
Unitrap ID UNI31727

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51287270..51287615 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078750 (AC105966.11)  


Sequence tag IST14285E5HMF1
Sequence
CTCATAATAAAGTAGAGACTTTTGTAGATGTGGAGGCATGCTCTAACCCTAGCGGTAGCTTTCCCAAGTAAAGGGACTGG
CTTGCTTTTTTATTTATTTCACTTTGGTGAGAGGGTAGTCTTTTGTTGTATAGTTCAGACTGGCCTGGTATCTAGGCGAG
GCTCCAACTCATAGCCAGCCTCCTGCCTCAGCCCCCCAGGTACTAGGATTGCAGAGTAAGCCNCCATACCTGGCTCAAGT
TTTTAAATGAAAGGGGACAGTGCATTTGAAAGCAGCCCTTTCTGGGTTTATGCTCCTGCAGTCTACATCTGANGAGTGAG
TCNNNNCAGGTGGCCTTCNNNCTGGAAANGCNAACATGCTNNNAN
Sequence Type genomic DNA
Unitrap ID UNI19527

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116997847..116998206 338
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST14285E5BBF1
Sequence
CTCNTAATANANTANANACTTTTGTAGATGTGGAGGCATGCTCTAACCCTANCGGTAGCTTTCCCAANTAAAGGGACTGG
CTTGCTTTTTTATTTATTTCACTTTGGTGANAGGGTANTCTTTTGTTGTATANTTCANACTGGCCTGGTATCTAGGCGAG
GCTCCAACTCATANCCNGCCTCCTGCCTCANCCCCCCAGGTACTAGGATTGCAGAGTAAGCCACCATACCTGGCTCAAGT
TTTTAAATGAAAGGGGACAGTGCATTTGAAAGCAGCCCTTTCTGGGTTTATGCTCCTGCAGTCTACATCTGANGAGTGAG
TCNCAGCAGGTGGCCTTCCNGCTGGAAAGGCCAACNTGCTCCTACNTCAANTGCTATCNNANNNATCANTTNNNCNNTTA
CAANNCNGCTNNTTNANTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es