Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14953B6
Clone ID IST14953B6
Vector VICTR76
Project tigm

Sequence tag IST14953B6HMR1
Sequence
GGCAGCAGTCAGCATAGTCCTGGGCCCTAAGTAGCCAGATCGAATCTACTGTGCAGTAATTTTATAAGTAAGCCATGCAG
CCCAGTACACTCACTTCTGTGGTCACTCAGAGTTGATGGTAGGTAGTGGTCGGGTAGTANATGGACTGGGCACTGGCATC
TCAGTGCTAACTGCTCCATGCGTCCTCCANCAGTTCCCGGAGCTCTGCAGCTTGACTGCAGCCACAGGGATGGTANACTC
TCATCATCANCTACAAGCAGCGTANTTCTGGAGTCANCACACTCTGCCATCAGCANCAGTGCTGTGGCGGGGGACTGGAA
GGAGCTGCTGACTGTTTCCATGTGTAAACTTGNCCN
Sequence Type genomic DNA
Unitrap ID UNI29651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42270034..42270388 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037287 (Tbcel) NM_173038 tubulin folding cofactor E-like Gene [Source:MGI Symbol;Acc:MGI:1925543]


Sequence tag IST14953B6HMF2
Sequence
CAAACTGGACTTCTTTTGTAGAGCACAACACACACATCCTTTCTTGGGCATCGCCGGGAGAGTCTGTTCCCGAACGTGTC
CTCCCAAGTCCCGAGACCTTCCCCTTGCTCANAACTGGGCAAGGTGCCCAAATCCGTTTATATGCAGTGCACCGGACTCT
GGCGGCGCATGCCCAGATCGGCAGAGTAGGGGTCAGGCGCCTCGCAGCGGAGGGCCGGCAGTTCCCGCCATTTTGTCCCG
CTCGCCACACCGCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131978449..131978704 254
NO GENE  


Sequence tag IST14953B6BBF1
Sequence
CTTAACAAAGCTTTCAGGTGTAATTCCCAACTGCTCTACGGTTACTGTGGTGAAGTCCAAAGGTGACTTAAAGGTATCAG
GGGTGCAAAGATTANGAGTCGCATCTGCTACATGCTTCTGAGGAGTCACAAACGGTTCAGTTCCCAATCTAAAAACGTCA
TTTTCTGAAAACGGACAGCACATTGGGGGTGTTAATACATCAAAACACTCAAATCTTCCATCTAACGAGGGCAACAGGTC
ACCACATACCAGAATTATTAAGGACACACTCCTTGGATTCANAGAGAGGCTTGTCGTGTGAACTCGCATCCATCTAAAAN
ATGAGGAAGTTANAGAAAAAAATGTGAAAAATAACCTCACTATAAGCNAAAAACAATGTGACAGAACTCTAAGGCAATCN
ATACCNGGGGACCACANGCTGGGGCGTTCTGATNAAANAAACGGCGGGAGGTACNNTTGACTAAACAAAGCGGNCCNNNC
TGATTTATCNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 68332750..68333238 457

 
Come back to gene Mm.33831


For any suggestions or comments, please send an email to unitrap@crg.es