Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G082B02
Clone ID G082B02
Vector U3CEO
Project ggtc

Sequence tag G082B02
Sequence
GTCGCCCCTACGCCATCGCTGTCTTTAAGAATGAGATCTACTGGGACGACTGGTCACAGCTCAGCATCTTCAGAGCTTCG
AAGCACAGCAGATCCCAGGGGGAGATTCTAGCAAGCCAGCTCACGGGCCTNCATCAACCTCATGTT
Sequence Type mRNA
Unitrap ID UNI11254

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 41839000..41839776 101
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049313 (Sorl1) NM_011436 sortilin-related receptor, LDLR class A repeats-containing Gene [Source:MGI (curated);Acc:Sorl1-001]

 
Come back to gene ENSMUSG00000049313


For any suggestions or comments, please send an email to unitrap@crg.es