Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10912C7
Clone ID IST10912C7
Vector VICTR76
Project tigm

Sequence tag IST10912C7HMR1
Sequence
TGGGACACCCAGACTGGGAGGCGCTCGTCTCTGGGGGTGGCAGGGATGACTGAGTGAAGTCGCCGAAAGGGGTTGGAGTT
CCCGCCGCGGCCCGACGAGCTCGGGGGTGGGGGTGGN
Sequence Type genomic DNA
Unitrap ID UNI7060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4998859..4998974 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]

 
Come back to gene ENSMUSG00000009079


For any suggestions or comments, please send an email to unitrap@crg.es