Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14264F7
Clone ID IST14264F7
Vector VICTR74
Project tigm

Sequence tag IST14264F7HMR1
Sequence
TGACTCCTTAGGGTTTAGACTTCTCGTTCGTACTCAGTTGAACGCTAACTCTAAAGTAAACCTTANATCTAATGAGAAAC
GCTTC
Sequence Type genomic DNA
Unitrap ID UNI2494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53741751..53741834 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000708 (Kat2b) NM_020005 K(lysine) acetyltransferase 2B Gene [Source:MGI Symbol;Acc:MGI:1343094]


Sequence tag IST14264F7BBF1
Sequence
GTCATGTNATTGAAGTTTCCCTCACCATGATAGCCACACCCCTGTTTTCTAAAAATTCTTCCAAGTACGGAGGGTAACCT
TAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53741667..53741754 86
NO GENE  

 
Come back to gene ENSMUSG00000000708


For any suggestions or comments, please send an email to unitrap@crg.es