Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14100A8
Clone ID IST14100A8
Vector VICTR74
Project tigm

Sequence tag IST14100A8HMF1
Sequence
CTATGTGATCCAAACTGGCTTCGAACTCGTGAATGGCCTCCTGCTTCAGTCTCCCAGCAAGGGGCTGTCTTTCAAAGGAG
CGAGCAAACCAGCCTCTGGCTACGAGGAAAGACCCACGTATGCCTCAGGTGAGCGGCTCTTCCAGCCACATTCAAGATGG
CGTCC
Sequence Type genomic DNA
Unitrap ID UNI31736

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 116168167..116168330 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020792 (Exoc7) NM_016857 exocyst complex component 7 Gene [Source:MGI (curated);Acc:Exoc7-001]

 
Come back to gene ENSMUSG00000020792


For any suggestions or comments, please send an email to unitrap@crg.es