Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14407G11
Clone ID IST14407G11
Vector VICTR74
Project tigm

Sequence tag IST14407G11HMR1
Sequence
TTTGCAAATAAAGCACATACATATGCATTAACCTTCAATGAAGCCATATTTGTTCATGGTAGTGGATAATTCTGTCCATT
GGAGAAGTTACTCAGAGTGTTTTGTTTGTTTTGTGTTTTCCGAAGATGGGAGTGTACTATAACCTGGTTCTCATTGAATA
TCTCAGG
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70348199..70348363 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


Sequence tag IST14407G11HMF1
Sequence
CATACACGCATCAATTTATACTCTCCATAGAGCATTTCTTTCTAGAGAGCTGTCCTGATAAATCTAACAGTGAATATTGA
AAGAACTAAAAATAGAAGCTATTAAATGTGGCACACACACACCCAAAACCAGAGGCTAGAAATGAACATTTATGAATTTT
ATACTCATTTTACTAATTGAGAAGGCTATAACTTCAAGAAAAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70348362..70348566 205
 
EST/CDNA Est Name
  CA883725.1


Sequence tag IST14407G11BBF1
Sequence
CCCTGACTTCATTTTTTAAAAAATTACTGTAGGCTTAAATTTTTCTCAACCCTAATTTTAATAGTGGTTCTTTTTTTTTT
TTTTTTTTTNNGNTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene CA883725.1


For any suggestions or comments, please send an email to unitrap@crg.es