Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14635H4
Clone ID IST14635H4
Vector VICTR74
Project tigm

Sequence tag IST14635H4HMR1
Sequence
NCNNAATGTCAAAAAGCCTGATTAGTTGGGTGTGGTGGTGCAGACCTTTAATCCCAGCACTGGGGGAGGCAGAGACAAGT
GGATCTCTGTGAGTTTGAGGCCNGCCTGGTCTACATAGGGAGTTCCAGGACAATCAGCACTATATAGAAGGACTGTCTCA
GACAGTAACAACNNCGCATGATTAGTGCTGAGCCCTGCTGGTCACTGCTCAGGAAGAGGGGCTCTCCCACAGANAGCANC
TGAGAATATGTGCTATATTTAGAGGACAACTTTNTCCAGGTTTTATATGANTTNCCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI30861

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33011980..33012274 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040183 (Ankrd6) NM_001012450 ankyrin repeat domain 6 Gene [Source:MGI (curated);Acc:Ankrd6-002]


Sequence tag IST14635H4HMF3
Sequence
GGTTTTATATTTGAGGACTTTATTAGTAGGAGAAAAATCTTGTTTTTTCTTTGCTTTATATTTCATTTGTTGCTTACTAA
GGCTGTTTGCTGTTGGTTTTGAAATGGCGGTGGGTAGGCACAGGTATCTGTCTGGAGTCACAGACTATCTGTGTGAGGTT
GGATCAAGGGAGCCTTTCTCTATCACTGTGTGCTTCTGGGATGTTTGCNTTCTGGCAACTTANCGTTNTTGCACTCNCNN
NGATGANCATGGANGTGTGCNCTTGNTACAGANACTGNCNNGANGGTCACAANANTGAANTCNNTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14635H4BBF2
Sequence
NANNNTGNNNNNNANNNNNNNTTTTAANNGCNNANAANANACNNNCCAANTCTTCAACTCCTAATATATTAATGCAAAGT
GCNTTTTCCCCCCTANCGACCTGTGATTCTGGCTCCTGTCAATGTCCCATTTGAACCCTGACCTTCGTTGCATTCATAAA
CTTTGCTTCACTTCTGCAAACCTTANCAAAAGTGAAGGGAAAAGAGGGTGGCCTGTTTGTTTATTTAGGCTGGCTTGGAA
CTTGGAGCCATCTTCAGGCCTAGGCCTANAGGATGAAGAATCTTAAGATGGGTATTTTTAACCTCAAAAACTACNATCTA
GGTCACAGTTCTAAGGAACACAAGAGAAACTTCTCAGTCACCCCACCTANTCACAGCTGGTCAAGATAAGCAGTCNCATG
GTAAAGGAAGCTGCATAATTTAAGCTTGANNGGTCTNAAATCGGTATGGGCAGACTTTCAACTGTCCATGACTTCAGCAG
TNNATGCNNNNCTGANGTNACGCCNGCCCAGGTCNCCNACAACANTGNNNGTTAAAAGTCTTGTTATGATCACNGCAANN
CNNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040183


For any suggestions or comments, please send an email to unitrap@crg.es