Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14096B10
Clone ID IST14096B10
Vector VICTR74
Project tigm

Sequence tag IST14096B10HMF2
Sequence
CCAGGGTCCAGGGCTAGGCATAGCCGCACCCGCACGTGTGGCCAGC
Sequence Type genomic DNA
Unitrap ID UNI31739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99075444..99075488 45
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071224 (AC121839.3-202)  


Sequence tag IST14096B10BBF1
Sequence
GAAATAACATCAGTATCTGCAAGAGACATTTACACTCCCACCGCTCTTCCAGCATCATTTCCATAGCAGTGATACGCGAC
CTCACCAGCAGACGAATGGACCAAGCACATGGAGGATGGGGCTCACGCACAGTGAATCATTTACTACAATATGGATGCAC
ACATGCAATACGCTAAAGAGGAAGGCAAGCACGGGGGATGGGGATGGCTCAGGGGCTGAGAGCCGCTATGGCTTTTGCAG
AGGACAGANTTNNNTCTCCTGACAGCTACNGTGCCTGGAACCCAAGCTGCAGGGAAGCCTATAGCTCTGGTTTCCGGGGG
GGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28518228..28518549 312
 
EST/CDNA Est Name
  BU787269.1 - CR516120.1

 
Come back to gene BU787269.1 - CR516120.1


For any suggestions or comments, please send an email to unitrap@crg.es