Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14465D5
Clone ID IST14465D5
Vector VICTR74
Project tigm

Sequence tag IST14465D5BBF1
Sequence
TTTTATGCTGCTTGTATCCTTGAACCCAAAATTGTGCAGCACTCATTGAAAATCAGTAATTTATTCTGCATTTTTGTTTC
TTTGAGGCAGGGATTTGCCTAGGCAGTCCTGGGACTTATGATGANCCTACCTTAGCCTCTANANTACTGGAAATATAAGC
TGCTCTAATATCCACTCCTANACACTGGGTTAACATAATCTATCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTC
TTCCTTCTTTCCTTCCTTCCTTCCTTTTTTTCTTTTTTTGATACCTGANATTNNNCCCAGGGCTGCTTACATGTGCTGGG
AGAGTACTCTTCCACTGANCTAATCTGTANTCCTGTTTNANTGTGGGTTTGTTTTTTNTTTN
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84864499..84864879 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST14465D5HMR1
Sequence
AAAANATTAAAACTAGCCCGGTGTGGTGGCACACGCCTTTGATCCCAGCACTCGGGAGGCAGAGGCAGGCGAATTTCTGA
GTTCGAGGCCNNCCTGGTCTACAAAGTGAGTTCCAGGACAGCCAGGGATATACAGANAAACCTTGTCTCNAAAAAAAAAA
N
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84864343..84864502 150
NO GENE  


Sequence tag IST14465D5HMF1
Sequence
TTTTATGCTGCTTGTATCCTTGAACCCAAAATTGTGCAGCACTCATTGAAAATCAGTAATTTATTCTGCATTTTTGTTTC
TTTGAGGCAGGGATTTGCCTAGGCAGTCCTGGGACTTATGATGAGCCTACCTTAGCCTCTAGAGTACTGGAAATATAAGC
TGCTCTAATATCCACTCCTANACACTGGGTTC
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84864499..84864689 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es