Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14568C4
Clone ID IST14568C4
Vector VICTR74
Project tigm

Sequence tag IST14568C4HMR1
Sequence
CAGCAGGAAGGANTTCCTGCCNNTGANCAGTAGCTCAGATGCCCTGACCCTGTCCCTGGGGATCTCAGAGGATCGCAGAG
AGCAGGGGAGCTGGAGACACCCCAGGGGCTCAGGCTGGAGCTGCTTCTGTGGGGCTGAGGAAGGAGGCCTTGGCAGTTCT
GTCCACGCTCCCCGCAGCACCTCCANCGCCACTTTAAAAACAGCTTTTTAATTTAACANAGTGGATGAAAAACTGTTTTT
GGAAATAAAAGATATCTGCTGTCTCCCAAGCTAGCACTCAGCCCTTGCANAGAGCCTCTCTCTGGGCTTCTGCTGGCTC
Sequence Type genomic DNA
Unitrap ID UNI17203

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41632380..41632697 304
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028444 (Cntfr) NM_016673 ciliary neurotrophic factor receptor Gene [Source:MGI (curated);Acc:Cntfr-002]


Sequence tag IST14568C4HMF1
Sequence
CTGTCTGGCTTCAGTCTCTCTTGCTGTAAGGAGTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41632695..41632764 70
NO GENE  

 
Come back to gene ENSMUSG00000028444


For any suggestions or comments, please send an email to unitrap@crg.es