Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10103D4
Clone ID IST10103D4
Vector VICTR76
Project tigm

Sequence tag IST10103D4BBR1
Sequence
CCACCCACTCCCCCTTTTTGGCCCTGGCGTTCCCCTGTACTGGGGCATATAAAGTTTGCAAGTCCAATGGGCCTCTCTTT
GCAGTGATGGCTTACTAGGCCATCTTTTGGTGTCTCTTGTATTAAAGAAAATAAACTTGGGACTGGATAGATGATTGCAT
GGTTAAGAGCACTTTTGTTTGCAGGTGATCCAGGCTTGGTTCCCAGCACCTATATGGCAGCTCACTGCTGTCTGTAACCC
CACTTCTAGGGATCTGATGTTCTTGTCCTCCAAGGCACACATGTGATGCGCATATATATACACACATGTAGGCAAACAGT
TATTACACATAAAATAAAAATGAACAAATACATAGTGAACTCAAAGTGTTGGACTGTCTGCAAGATGAAGAAAAAGAAAA
TGCAGGAAGTTAACCTCTTTGGATTTAATTGGATTGTAGTTTGTTCTGGACCAGGCAAATTCAGGTCACTCCAGTTTTTA
TAGCATTGAAGATTTACTCATGCATTTATTTACTCATTTTTGTGACATAATGAATTTTTTTGTCATTGTCACTTGTTTTA
GAAATCAAAGGCCCTTTGTTTAGGCCAGAGATTGATGGA
Sequence Type genomic DNA
Unitrap ID UNI468

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62267254..62267850 591
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]


Sequence tag IST10103D4BBF2
Sequence
AGTACATTGTAGTTCTCTTCAGACACACCAGAAGAGGGCACCCGATCTG
Sequence Type genomic DNA
Unitrap ID UNI30621 UNI34691 UNI34692

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 87796739..87796786 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021255 (Esrrb) NM_011934 estrogen related receptor, beta Gene [Source:MGI (curated);Acc:Esrrb-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 13754569..13754616 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019726 (Lyst) NM_010748 lysosomal trafficking regulator Gene [Source:MGI Symbol;Acc:MGI:107448]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 109656115..109656162 46
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059857 (Ntng1) NM_030699 netrin G1 Gene [Source:MGI Symbol;Acc:MGI:1934028]

 
Come back to gene ENSMUSG00000059857


For any suggestions or comments, please send an email to unitrap@crg.es