Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14733G4
Clone ID IST14733G4
Vector VICTR76
Project tigm

Sequence tag IST14733G4HMF1
Sequence
TTTNCTTTCCCCCTTCCTGTCCTTCTATGACTATATACTGATGAATCTGGAATCGTACCATTCATACACTTTAAAAGGTG
CTTCCCAAATCATGACATCTCCCAAAACTATGATTTTAATGGCTCTAAGTTCTACCAAGAGACCACAGAAATATAATTTC
CTCAAAGTTAAACTCCTGGCTCTTATACAAATGTGACGAAGATTTTTTTTTCTTTCATTTATGAAGTGGA
Sequence Type genomic DNA
Unitrap ID UNI29581

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 45871137..45871365 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011256 (Adam19) NM_009616 a disintegrin and metallopeptidase domain 19 (meltrin beta) Gene [Source:MGI (curated);Acc:Adam19-001]

 
Come back to gene ENSMUSG00000011256


For any suggestions or comments, please send an email to unitrap@crg.es