Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G078H11
Clone ID G078H11
Vector U3CEO
Project ggtc

Sequence tag G078H11
Sequence
TCTCGCTCTCTCTCGNNGCTGCAGCCTAGTAGGGGCNGTTCGTCCAGCATGAGCTCGGACATGGCAGCCGACGAGTCGGA
GGCCCCAGTACTCTCGGAGGACGAGGTATGGGAGTTTTGCCTGGATAAGACAGAAGATGGTGGCGGATCCCCCGGAAGTG
ATGTTACAGACACTTGTGAGCCTCCATGTGGATGCTGGGAGTTGAATCCGAATTCCCTGGAAGAGGAGCACGTGCTGTTC
ACTGCTGATCCGTACCTGGAGCTCCACAACGAGTACACACGAGATGTAGAGTGAAGGTTATAGCTGGCATAGGCCNNTCC
AAGAAAGANNNNCTGGGAGCCAG
Sequence Type mRNA
Unitrap ID UNI2626

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72510316..72519110 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es