Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CD0291
Clone ID CD0291
Vector pGT0lxfT2
Project sanger

Sequence tag CD0291
Sequence
CTGTGCAGGATTTGATCGGGTAGACCTCCCTTGCTTGCTGCTCCCAGCTGCCTGGTCTTGAATACCATCATGGCCAAACC
TTACGAATTTAACTGGCAGAAGGAAGTGCCCTCTTTCTTGCAAGAAGGAGCAGTTTTTGACAGATACGAAGAGGAATCTT
TTGTGTTTGAGCCCAACTGCCTCTTCAAAGTAGATGAATTCGGCTTCTTCCNTTTTTCCCACCGGCGGGAGATGTCGACT
TTTTTTTTTTTTTTCATTTTTTTCTTTTTTATTCCGATAATCTTCCATTTCATTTTCCTCCATCTTTCCCTATCAATCCT
TTCCTGTTGTTTCTTCATTTAATTCTTTTGTCCCCATTACTTTCTGCTGCCTGCCCTCTTACCTTCGACTCTCCTTTATT
TCTTCACTTCTTTTGAATTGCTGAAAATCCAGAAGTAACTAAG
Sequence Type mRNA
Unitrap ID UNI1476

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 135631288..135735980 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039943 (Plcb4) NM_013829 phospholipase C, beta 4 Gene [Source:MGI (curated);Acc:Plcb4-002]

 
Come back to gene ENSMUSG00000039943


For any suggestions or comments, please send an email to unitrap@crg.es